We attempted Rapamycin concentration to make in-frame deletions internal to individual dnd genes at their corresponding PLX3397 molecular weight chromosomal loci to avoid polar effects. Apart from the dndB in-frame deletion mutant HXY2 [8] (Fig. 3), extensive efforts to obtain mutants specific to other dnd genes directly on the wild-type S. lividans 1326 chromosome failed for unknown reasons. We therefore attempted to develop a mutation-integration system by first generating a complete set of in-frame deletions of individual dnd gene in vitro in E. coli. These mutated dnd genes were then integrated back into the chromosome of S.lividans HXY6 (generated by targeted deletion of the complete dnd locus, [8]).

A complete set of pSET152-derived integration plasmids with targeted in-frame deletions of the five dnd genes was generated by PCR and cloned into E. coli [detailed in Methods, pHZ2862 (651-bp deletion in dndA); pJTU1202 (729-bp deletion in dndB); pJTU1211 (819-bp deletion in dndC); pJTU1214 (1,704-bp deletion in dndD); and pJTU1219 (216-bp deletion in dndE), respectively]. These plasmids were introduced into HXY6 to obtain mutants XTG1-XTG5 with in-frame deletions in dndA-E in a uniform parental background. Isogenic mutant strains (XTG1-XTG5) were assayed for their

Dnd phenotype. Interestingly, while the Dnd phenotype, as displayed by degradation of chromosomal AC220 molecular weight (Fig. 4A) or plasmid pHZ209 (Fig. 4B) DNA isolated from strains XTG1, XTG3, XTG4, and XTG5 (corresponding to dndA, C, D, E) was clearly abolished, DNA isolated from XTG2 retained the Dnd phenotype, clearly showing that dndA, C, D, and E are all essential for DNA phosphorothioation. Single-stranded DNA modification, which should be indicated by shifting of the covalently closed

circular (CCC) to the open circular (OC) form for plasmid pHZ209 DNA if cleaved by the electrophoresis buffer, was not observed with these mutants (Fig. 4B), as also found for HXY1 (data not shown). Figure 4 Dnd phenotype of 1326 and related dnd mutants. (A) Dnd phenotype of chromosomal DNA for 1326 and related dnd mutants. (B) Dnd phenotype of plasmids pHZ209 isolated from 1326 and related dnd mutants. (C) Dnd phenotype of chromosomal 4��8C DNA from complemented dnd mutants. DNA was first treated with TAE (top panel) or peracetic acid TAE (bottom panel) before fractionation by electrophoresis in TAE with added thiourea. M: DNA markers; CCC: covalently closed circular plasmid; OC: open circular plasmid. L: linear plasmid. A close comparison of the Dnd phenotypes displayed by the wild-type 1326 and the dndB mutant XTG2, however, revealed a clear difference. The degradation “”smear”" from the genomic DNA of XTG2 migrated much faster than that from wild-type strain 1326 (Fig. 4A). Smaller genomic DNA fragments, or more frequently degraded genomic DNAs, were observed in the mutant XTG2 than the wild-type strain 1326.

CrossRef Competing

interests The authors declare that they have no competing interests. Authors’ contributions ZPL planned and performed the experiments, collected and analyzed the data, and wrote the paper. KBT supervised the project, analyzed the results, and wrote the paper. QYH and LLW helped with the synthesis of the AL3818 materials and the collection of the data. RT did the Rietveld fit of the obtained polytypic nanoplates. All the authors discussed the results and commented on the manuscript. All authors read and approved the final manuscript.”
“Background Metamaterials (MMs) Temozolomide concentration are artificially engineered composites that attract considerable interests due to their exceptional electromagnetic properties, which are not typically found in nature, such as negative refractive index and cloaking [1–4]. These MMs with various subwavelength resonant elements have offered magnetic and/or electric resonant eFT508 concentration responses to incident electromagnetic radiation, scalable from the microwave frequencies up to the terahertz and optical ones [5–7]. Particularly, nanohole resonators embedded in metal-dielectric-metal (MDM) multilayers are frequently used as building blocks of negative-refractive-index MMs [8–11], owing to

the coupling between surface plasmons counterpropagating on the two closely spaced interfaces which results in a closed loop of the electric currents. This gives rise to magnetic dipolar resonances between the two coupled metal layers, while the continuous

metallic strip parts provide the electric resonance moments [12, 13]. All these features make the nanohole array perforating through MDM films become a strong candidate for developing three-dimensional negative-index MMs [14, 15]. One of the obstacles in this progress is the resonance responses of MMs to the impinge light Cediranib (AZD2171) which are usually fixed once the dimension of the structure is determined, thus making the MMs possess a limited bandwidth. However, for many applications (switching, modulation, filtering, etc.), it would be highly desirable to tune the MM resonances over a wide bandwidth. To this end, tunable photonic MMs, the spectral range of which can be controlled by changing the dielectric environment of the resonator with liquid crystals (LCs) [16–18]; phase transition materials [19, 20]; and optical pumping [21, 22] have been discussed recently. However, the challenge is to develop tunable MDM-MMs in the near-infrared (NIR) regime. It is due to the fact that frequency tunability of the MDM-MM mainly requires for the interlayer dielectric material to possess a tunable effective dielectric constant in the NIR region, hence limiting the choice of the active materials. Here, we take a different approach to actively tune the resonant frequency of the MDM-MMs in the NIR regions by using bismuth selenide (Bi2Se3) as the dielectric layer. Recently, a rising Dirac material – topological insulators (TIs) – had been intensively researched in condensed matter physics [23, 24].

A mutant for the gene Rv0442c, known to be attenuated in the macrophage model, is included as a control. All CFU counts are represented as mean ± standard deviation. M. tuberculosis pknD is necessary for invasion of CNS-derived endothelia To determine whether the observed phenotype was due to a specific interaction with host cells likely to encounter M. tuberculosis in CNS or lung tissues, invasion MK-4827 concentration assays were performed in activated J774 macrophages and non-professional phagocytic

cells [CNS-derived BMEC (HBMEC), A549 alveolar basal epithelial cells, and umbilical vein endothelia (HUVEC)]. HUVEC and A549 were chosen as they represent the most commonly used endothelial and pulmonary epithelial cells, respectively, employed for pathogen studies. Infections were performed with M. tuberculosis wild-type, pknD mutant, or a strain which was complemented with the pknD/pstS2 operon. Strain CQ0688, an intergenic M. tuberculosis Tn mutant, was used as a negative control, while M. tuberculosis Rv0442c mutant, known to be attenuated in macrophages [16], was used as a positive GDC-0941 price control BIBW2992 for macrophage experiments. The pknD mutant demonstrated an invasion defect in HBMEC after 90 minutes

of infection (P = 0.02), a defect restored by complementation (Figure 1B). These results were confirmed in three independent experiments. Invasion of A549 or HUVEC by the pknD mutant was not significantly lower than that of wild-type (Figure 1B). Since macrophages are the key host cells that interact with M. tuberculosis Thymidylate synthase in the lungs, bacterial survival assays were also performed to assess the role of pknD in activated J774 macrophages. Host cells were lysed and bacteria cultured at days 0, 1, 3, 5, and 7 following infection. Bacterial counts for the pknD mutant remained below that of wild type bacteria in HBMEC at days 3 (P = 0.008), 5 (P = 0.03), and 7 (P = 0.003) during the course of the infection (Figure 1C). When accounting for the reduced invasion at

day 0, an intracellular survival defect was still observed at days 5 (P = 0.03) and 7 (P = 0.03). No corresponding defect was observed for the pknD mutant at any time point in macrophages (Figure 1D). These data indicate that the CNS-associated defect of the pknD mutant may be due to defective invasion and survival in brain endothelia. The PknD extracellular domain is sufficient to trigger adhesion and invasion of brain endothelia In order to determine whether the presence of PknD protein is sufficient for invasion, fluorescent microspheres were coated with either recombinant PknD sensor or bovine serum albumin (BSA). Host cell actin cytoskeleton was stained with Alexafluor 488-Phalloidin. Coated microspheres were incubated with brain endothelia (HBMEC) for 90 minutes, followed by extensive washing. Confocal microscopy demonstrated that higher numbers of PknD-coated microspheres adhered to HBMEC than in the case of BSA-coated control microspheres (Figure 2A-B).

In these cases, the post processing, such as low rotation-rate centrifugation [20] or special separation technique [23] to purify nanowires, is usually indispensable. Therefore, it is highly desirable to develop a reliable and facile method for the synthesis of silver nanocrystals in high yield with uniform size. In the polyol process, acting as stabilizer, PVP plays an important role in controlling the shape. Chou et al. [24] compared

the ability of PVP to stabilize silver colloids in the presence of NaOH or Na2CO3. Liu et al. [25] also proposed that the crystal structure shape was related to the capping modes between PVP with different molecular weights (MWs) and silver nanocrystals. Although the changes arising from the addition of PVP with different MWs have been observed in previous Lazertinib works, the exact function of the MW of PVP on the formation of silver nanocrystals has not been clarified until now. In this work, we deeply studied the role of MW of PF-04929113 molecular weight PVP in the shape control of silver nanocrystals. According to optical spectroscopic analysis and statistic of the yield and average size of each product prepared by varying the MW and concentration of PVP, we obtained the relationship between the MW of PVP and preferential products. By analyzing the interaction between PVP with different MW and silver crystals by Fourier transform infrared

(FT-IR)spectroscopy, we deduce the role of PVP in the nucleation and growth processes. The results suggest

that we provide a facile and robust strategy for the synthesis of well-shaped silver nanocrystals in high yield. Methods Silver nitrate (AgNO3 99 + %), sodium chloride (NaCl), and ethylene glycol (EG) were all purchased from Nanjing Chemical Reagent Co. Ltd (Nanjing, People’s Republic of China). Polyvinyl pyrrolidone (PVPMW=8,000, PVPMW=1,300,000) were purchased from Aladdin (Shanghai, People’s Republic of China). PVPMW=29,000 and PVPMW=40,000 were purchased from Sigma-Aldrich (St. Louis, MO, USA). We used a colloidal synthesis method improved from the literature [26]. The method is one of the main methods for silver nanowire preparation. However, we found that when PVPMW=40,000 was used in this method, there are always plenty of by-products such as nanospheres second and nanocubes unless the reaction condition was strictly controlled. It provides us an opportunity to exhibit the role of MW and the concentration of PVP in the synthesis process using this method. In each synthesis, l-mL EG solution of AgNO3 (0.9 M) and 0.6-mL EG solution of NaCl (0.01 M) were added into 18.4-mL EG solution of PVP (0.286 M). Then, the mixture was refluxed at 185°C for 20 min. After these processes, the excess PVP and EG were find more removed by adding deionized water centrifuged at 14,000 rpm for 10 min, three times.

4, 49 ± 2.0 and 44 ± 2.8% in the competition, exclusion Cl-amidine chemical structure and displacement assays, respectively (Figure 5). Figure 5 Inhibition of adhesion of C.albicans to vaginal epithelial cells. (a) Treatment of vaginal epithelial cells with 1×107 L. crispatus. C. albicans to Vk2/E6E7 cells was assessed by microscopy (×100) after Gram’s stain by counting the number of micro-organisms attached to 30 consecutive cells. The results of the three conditions (i.e. exclusion, competition and displacement) were expressed as the average number of C. albicans per Vk2/E6E7 cells and compared with adhesion

without lactobacilli (control value). The control values were taken as 100% of adhesion and the inhibition of C. albicans adherence was calculated by subtracting each adhesion percentage from their corresponding control

value. (b) Treatment of vaginal epithelial cells with 1.0 mg/mL EPS. C. albicans to Vk2/E6E7 cells was assessed by microscopy (×100) after Gram’s stain by counting the number of micro-organisms attached to 30 consecutive cells. The results of the three conditions (i.e. exclusion, competition and displacement) were expressed as the average number of C. albicans per Vk2/E6E7 cells and compared with adhesion without EPS (control value). The control values were taken as 100% of adhesion and the inhibition of C. albicans adherence was calculated by substracting each adhesion percentage from their corresponding control value. The data are expressed as the mean ± SD percentage of adherence in Dasatinib mw three independent experiments. The asterisks indicate a statistically significant difference between C. albicans grown in the presence of viable or heat-killed L. crispatus versus C. albicans alone. *P < 0.05, **P < 0.01. Moreover, confluent cell monolayers were treated with increasing concentrations of EPS, isolated and purified from L. crispatus L1, and successively infected with C. albicans. The AZD0156 molecular weight concentration required to interfere with yeast adhesiveness was equal to 1.0 mg∙ml−1. Figure 5b shows the effect of EPS on the adhesion of C. albicans to vaginal epithelial cells under

the conditions of exclusion, competition and displacement. The adhesion interference was of about 48% in the exclusion assay, when the monolayers were pre-treated with 1.0 mg∙ml−1 EPS for 18 h and before addition buy Rapamycin of the C. albicans suspension. In the competition and displacement tests the reduction in adherence was comparable to that obtained in the control experiment. A set of experiments was performed to determine whether HBD-2 was secreted by vaginal epithelial cells treated with increasing concentrations of EPS. HBD-2 ELISAs showed that the concentration of HBD-2 protein was significantly high in the supernatant after 18 h treatment (Figure 6). Interestingly, the plateau was reached at the same concentration (100 mg∙l−1). Figure 6 HBD-2 levels in Vk2/E6E7cells after treatment with EPS (0.01-0.1-1.0 – 5 mg/mL) secreted by L. crispatus L1.

A total of 15 recreational male Ironman triathletes volunteered to participate in the study; they all finished the race successfully within the time limit. The characteristics of their anthropometry and training are represented in Table 1. The study was approved Acadesine by the Institutional Review Board for the Use of Human Subjects of the Canton of Zurich, Switzerland, and all athletes gave their informed written consent.

Table 1 Characteristics of the subjects ( n  = 15). Results are presented as mean ± SD   Result Age (years) 40.1 ± 6.8 Body mass (kg) 71.3 ± 9.3 Body height (m) 1.75 ± 0.05 Body mass index (kg/m2) 23.0 ± 2.2 Years of pre-race experience 7.4 ± 4.9 buy Caspase Inhibitor VI Weekly swimming kilometres (km) 6.3 ± 2.8 Weekly swimming hours (h) 2.8 ± 1.5 Speed GSK1210151A in swimming during training (km/h) 3.2 ± 0.4 Weekly cycling kilometres (km) 202.3 ± 81.5 Weekly cycling hours (h) 7.8 ± 3.0 Speed in cycling training (km/h) 28.5 ± 2.7 Weekly running kilometres (km) 43.5 ± 16.0 Weekly running hours (h) 3.8 ± 1.1 Speed in running during training (km/h) 12.0 ± 1.7 The race A total of 2,203 male Ironman triathletes from 49 countries started in the morning at 07:00 a.m. At the start, the air temperature was 14°Celsius and the water temperature in Lake Zurich was 20°Celsius. Wetsuits were allowed

due to the low water temperature. At the start, the sky was clear and Phenylethanolamine N-methyltransferase became cloudy slowly during the afternoon and evening. The highest temperature, 23.2°Celsius, was reached in the afternoon. Humidity was at 69% in the morning and dropped to 37% in the afternoon. Barometric pressure was at 1021.5 hPa at the start and rose to 1014.9 hPa in the afternoon. The athletes

had to swim two laps in the ‘Lake Zurich’ to cover the 3.8 km distance, and then had to cycle two laps of 90 km each, followed by running four laps of 10.5 km each. In the cycling part, the highest point to climb from Zurich (400 metres above sea level) was the ‘Forch’ (700 metres above sea level), while the running course was flat in the City of Zurich. Nutrition was provided for the cycling and running courses by the organisers. They offered bananas, energy bars, energy gels and carbohydrate drinks as well as caffeinated drinks and water on the cycling course. On the running course, in addition to the aforementioned nutrition, different fresh fruits, dried fruits, nuts, chips, salt bars and soup were provided. Measurements and calculations Upon inscription to the investigation, the participants were instructed to keep a training diary until the start of the race. All training units in swimming, cycling and running were recorded, showing distance in kilometres and duration. The day before the start of the race body mass, body height, the circumferences of the mid-upper arm, mid-thigh, and mid-calf and the thicknesses of eight skin-folds (i.e.

Supplementation of 225 mg per day of enteric-coated ATP supplementation for 15 days resulted in increased total bench press lifting volume as well as within-group repetitions to failure on set one of three with 70% of 1RM [3]. Moreover, 15 days of 400 mg per day of ATP supplementation reduced learn more muscle fatigue and enabled a higher force output during repeated high-intensity

bouts of exercise [4]. More recently, 12 weeks of 400 mg of oral ATP disodium salt supplementation in resistance-trained athletes utilizing a periodized resistance-training program (RT) resulted in significant increases in lean body mass, muscle thickness, total strength and vertical jump power [5]. ATP also reduced protein breakdown and limited the loss of strength and power during an Wortmannin cost overreaching cycle [5]. Three distinct mechanisms-of-action have been proposed for orally administered ATP’s ergogenic benefits: 1) ATP can increase blood flow, resulting in improved oxygen and nutrient delivery to the muscle [5] 2) ATP may increase muscular excitability [6]; 3) ATP can trigger signaling cascades for metabolic adaptation related to neuromuscular activity (phosphorylation of ERK1/2) (see Figure  1) [7]. However, it is unlikely that oral ATP administration will directly increase intramuscular ATP stores. Figure 1 Proposed mechanism-of-action of oral ATP administration.

Erythrocytes eFT-508 purchase function as an oxygen sensor, contributing to the regulation of skeletal muscle blood flow and oxygen delivery, by releasing ATP in proportion to the number of unoccupied oxygen binding sites in the hemoglobin molecule. ATP release results in vasodilation and greater blood flow to the working musculature, thereby enhancing nutrient and oxygen delivery. Thus, during exercise under hypoxic conditions, ATP is released from the red blood cells via pannexin channels. ATP then binds to the purinergic receptors on the endothelial cells [5].

The endothelial cells then produce endothelium-derived hyperpolarizing factor, prostacyclin, and nitric oxide, all of which serve to relax the smooth muscle of the vasculature (see Figure  1) [5]. Infused ATP has BCKDHB been shown to increase blood flow by stimulating endothelial ATP-selective P2Y2 receptors and increasing muscle sympathetic vasoconstrictor activity [8]. The vasodilatory and sympatholytic effects of exogenous ATP are mediated via ATP itself rather than its dephosphorylated metabolites [9]. Chronic oral administration of ATP in rats increased portal vein ATP concentration and nucleoside uptake by erythrocytes, which resulted in an increase in ATP synthesis in the erythrocytes [10]. To our knowledge, however, no studies have delineated if oral ATP administration enhances the blood flow response to exercise.

First, we examined the overall structural

characteristics of biofilms formed after 24 h using CLSM (Figure 2d-f; Additional file 1: Figure S1a-f). The average biofilm thickness (see Methods section) differed among all three strains with M1 producing find more considerably thinner biofilm (mean value of 9 μm) compared to M28 (12 μm) and M41 (15 μm), a result consistent with lower spectrophotometric absorbance values (Figure 1a). In addition to measured differences in biofilm thickness, closer examination of the X-Y orthogonal Z-stack views, representing biofilm cross-sections, revealed architectural differences among the M41, M28, and M1 biofilms. The M1 biofilm, although the thinnest, seems to consist of densely-packed cells that form continuous layers, while the M28 and especially M41 biofilms seem to be less dense but exhibit more elevated supracellular assembly. We therefore used field emission scanning electron microscopy (FESEM) https://www.selleckchem.com/products/pexidartinib-plx3397.html to define more accurately these supracellular differences observed by CLSM between the biofilms produced by the WT M1 and

M41 GAS (Figure 3). FESEM exposed notable architectural differences between biofilms formed by these two strains. The M41 (Figure 3, panel a) biofilm was characterized by more diverse surface architecture with the evidence of depressions or crypts, whereas the M1 biofilm (panel b) seems to lack such pronounced surface characteristics. At higher magnification, the M41 cells have a studded cell surface morphology with protrusions linking both sister cells and cells in adjacent chains (panel c). In contrast, the M1 cells had CH5183284 order a relatively smoother appearance likely due to the rich bacterial-associated extracellular matrix (BAEM) surrounding these cells and covering their surface (panel d). BAEM material, which was clearly seen at higher resolution between the M1-type cells, was not as evident between cells of the M41-type GAS. Figure 2 Biofilm formation by wild type and scl1 -inactivated isogenic mutants.

Crystal violet staining and confocal laser scanning microscopy (CLSM) of the GFP-expressing GAS were used to compare biofilm learn more formation by GAS strains. Wild type (WT) M41-, M28-, and M1-type strains, scl1-inactivated mutants (scl1), and M41 mutant complemented for Scl1.41 expression (M41 C) were used. (a-c) Isogenic GAS strains were grown under static conditions for 24 h and bacterial biomass was detected spectrophotometrically at indicated time points following crystal violet staining. Absorbance values at OD600 are representative of at least three experiments performed in quadruplicate. Statistical significance is denoted as *P ≤ 0.05 and **P ≤ 0.001. (d-f) CLSM analysis of corresponding 24 h biofilms from same experiment. Images are X-Y orthogonal Z-stack views of WT (top) and mutant (bottom) GAS strains. Views are representative of ten images within a single experiment.

The luciferase activity increased in the parent Newman in a growth phase dependent manner from the exponential towards the stationary phase and declined thereafter (Figure 3A). The course of luciferase activity in the ΔyabJ-spoVG mutant

SM148 and in the ΔrsbUVW-sigB mutant IK184 was comparable but the overall activity was reduced by a factor of two in SM148, whereas it was two up to four times higher in IK184. These effects were also mirrored by the intensity of the esxA specific transcripts (Figure 3B). Since esxA transcription in strain MS64 [24], a mutant with a stop in sigB inactivating σB, was indistinguishable from that in IK184, we could assign the upregulation of esxA transcription

4SC-202 purchase to the loss of σB and exclude any contributions of rsbUVW (data not shown). Figure 3 Effect of σ B and σ B -controlled SpoVG on esxA expression. A. Transcriptional activity of the esxA promoter in strain Newman (squares), SM148 (triangles), and IK184 (diamonds). Growth was followed by measuring the optical density at 600 nm [OD600] (open signs), and the activity of the esxA promoter was determined by the luciferase activity of pesxAp-luc + (filled signs). B. Northern blot analysis of esxA transcription in Newman, the ΔyabJ-spoVG mutant (SM148) and the

JQ-EZ-05 nmr ΔrsbUVW-sigB mutant (IK184) over growth. C. Northern blot showing esxA transcription in Newman, the ΔyabJ-spoVG mutant (SM148) and the ΔrsbUVW-sigB mutant (IK184) complemented with pBus1, pyabJ, pspoVG or pyabJspoVG after 5 h of growth. Ethidium bromide-stained 16S rRNA www.selleckchem.com/products/E7080.html patterns are shown as an indication of RNA loading. To determine if either yabJ or spoVG inactivation was responsible for the reduction of esxA transcription, we complemented Newman, SM148 and IK184 in trans with Non-specific serine/threonine protein kinase a series of plasmids expressing constitutively either yabJ (pyabJ), spoVG (pspoVG), or yabJ-spoVG (pyabJspoVG), circumventing the requirement of σB to transcribe the yabJ-spoVG operon. Northern blot analysis revealed that the constructs containing spoVG or yabJ-spoVG, but not the one carrying yabJ, did restore the esxA transcription to wild type level in SM148 (Figure 3C). In IK184, showing stronger esxA transcription signals than the wild type, the esxA transcription was even further enhanced by the complementation with pspoVG or pyabJspoVG, confirming that SpoVG, but not YabJ, had a positive effect on esxA expression in presence and absence of σB.

Using exclusively the NCTC 11168 genome based primers a significant lowered ceuE-detection rate was only observerd for group 2 isolates (24.0%, p < 0.002). There were no significant differences in the pldA detection using additional 81–176 genome-based primes in our study population. Table 2 Primer Gene Primer name Sequence 5’-3’ Annealing temp Reference cj0178 cj0178-F01 TGTAGGCGGGGGTGGCAAGA 54.0°C this study cj0178-R01 ACGACCGCGAGCAGAATTGC

cj0755/cfrA cj0755/cfrA-F01 ATGGCCGCGAAGTCGTAGGG 54.0°C this study cj0755/cfrA-R01 AGCGATCTATTTGCCACTCGCCT GSK458 cost cj1321 LY411575 cost CjNCTC11168-1321_f AAAATGTCATCATCATAGGAGCG 60.0°C [6] CjNCTC11168-1321_r TCTAAGTTTACGCAAGGCAACA cj1322 CjNCTC11168-1322_f GACTTTGGTTTAATGGGTAAGCA 59.6°C [6] CjNCTC11168-1322_r TTCCGGCGTTAAAATTAGAAAA cj1323 CjNCTC11168-1323_f AGAACGATTTACCCCATTGAAA 59.7°C [6]

CjNCTC11168-1323_r ATTTGCTAAAGCTCCTCGATTG cj1324 CjNCTC11168-1324_f TGCCGTAAGTGGAGGTAAAGAT 60.0°C [6] CjNCTC11168-1324_r TCTGCACACATTGTTCTATCCC cj1325 CjNCTC11168-1325_f ACGGATTACTTTTTCCAGATGGT 60.0°C [6] CjNCTC11168-1325_r TTTGCTTTGAAAATACGCTGAA cj1326 CjNCTC11168-1326_f TACATTTCATCGATAAAGCCGA 59.7°C [6] CjNCTC11168-1326_r AAATATAATGGTGTGCCGATCC fucP cj0486FWD GATAGAGCATTAAATTGGGATG 52.0°C [8] cj0486REV CCTATAAAGCCATACCAAGCC rpoC GAACTTGCTATTGCTGAGCC rpsL ACCCTAGTGCAAACTCCCCT ceuE ceuE-81176F01 GATAGAGTCGCAGGCGTTCC 60°C this study ceuE405F GATAAAGTCGTTGGCGTTCC [7] ceuE405R GCGAGATTGGAGGACCAAAGG JIB04 cell line pldA pldA-81178F01 AAACTTATGCGTTTTT 45°C this study pldA-84fwd AAGCTTATGCGTTTTT [7] pld-981rev TATAAGGCTTTCTCCA cstII orf7ab ACTACACTTTAAAACATTTAATCC AAAATCA 56°C [14] orf7ab CCATAAGCCTCACTAGAAGGTATGAGTATA cstIII orf7c TTGAAGATAGATATTTTGTGGGTAAA 56°C [14]   orf7c CTTTAAGTAGTGTTTTATGTCACTTGG     Furthermore, we included the genes cj0178, an outer membrane siderophore receptor, and cj0755, an iron uptake protein (ferric receptor), in the panel of marker genes. The gene products of cj0178 and cj0755 are like enterochelin, CeuE, involved in the microbial iron uptake. Thus, it was, because of their functional association to CeuE, suggestible

Erastin mw that they may be associated with bloody diarrhea like ceuE[7] as well. Both genes could be detected, mostly associated with each other, in more than 76% of all isolates. In the groups 2 (A + B) and 4 they are nearly completely absent, whereas about 100% of the remaining groups are positive for both genes. Additionally, we looked for the presence of cstII and cstIII in order to distinguish isolates with sialylated LOS from isolates with non-sialylated LOS. There are already more detailed studies associating MLST CC with certain LCC [3, 15, 16] allowing us to associate a particular isolate group with specific LCC only on the basis of the MLST-CC and the information about the absence or presence of cstII and cstIII (see Table1 and Figure1).