Quantitative real-time PCR qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad,USA) on a CFX96 Real-Time Detection System (Bio-Rad, USA). For host gene expression, the thermal cycle conditions were performed as described previously [18]. The expression levels of Drosomycin, Diptericin, and Cecropin A1 at 18 hours post infection in the flies were normalized to the house keeping gene ribosome protein 49 (rp49) [18]. For bacterial gene expression, the expression levels of hla, hlg, sak, sspA, and hysA in different

strains growing in BHI broth GSK-3 inhibitor at mid-log and stationary phases and inside the flies were normalized to the control gene, gyrB, encoding DNA topoisomerase subunit B [19]. All primers used for qRT-PCR are listed in Table 1. Relative target gene expression was calculated according to the ΔΔCt method, in which the fold difference in expression was 2-ΔΔCt[20]. The experiments

were repeated at least three times. Student’s t-test analysis was performed to determine significant differences of the host gene expressions in response to different MRSA strains and the virulence gene expression among different strains. Table 1 Primers used for qRT-PCR analysis Primers Sequence (5′ to 3′) Ref rp49 F GACGCTTCAAGGGACAGTATCTG [18] rp49 R AAACGCGGTTCTGCATGAG [18] dpt- F GCTGCGCAATCGCTTCTACT [18] dpt- R TGGTGGAGTGGGCTTCATG [18] dro-F CGTGAGAACCTTTTCCAATATGATG [18] dro-R TCCCAGGACCACCAGCAT [18] cecA1-F TCTTCGTTTTCGTCGCTCTC [18] cecA1-R GNAT2 CTTGTTGAGCGATTCCCAGT [18] hla-F CTGATTACTATCCAAGAAATTCGATTG This study hla-R CTTTCCAGCCTACTTTTTTATCAGT Ku-0059436 research buy This study hlg-F ATAGAAGATATCGGCCAAGG This study hlg-R TTGCATCTTAACAACTAGGGC This study sak-F GACGCGAGTTATTTTGAACC This study sak-R TCTTTTGTAAGTGTAGTCCCAGG This study hysA-F GTTTGATGCTACA GAGAAAGAGG This study hysA-R CTGCGATTTTCTCAATATTACG This study sspA- F GGGT TATTAGGTTG GTCATCG This study sspA-R AAGTGATCGGAATTCATTGG This study gyrB-F ATCGACTTCAGAGAGAGGTTTG

[19] gyrB-R CCGTTATCCGTTACTTTAATCCA [19] Results MRSA strains with greater propensity to cause clinically invasive human infection showed increased fly killing activities We tested both feeding and pricking methods to compare the virulence of clinical MRSA strains in the fly model. Feeding experiments did not show significant differences among these strains in terms of the killing activities (data not shown). However, pricking experiments demonstrated that different clinical MRSA strains had distinct killing activities. Flies injected with plain BHI broth were included as a negative control, for which no flies were killed during the whole period of the experiment. USA300, USA400 and CMRSA2, previously shown to have a greater propensity to cause clinically invasive human infection [6], demonstrated high killing activities, with 51.4%, 60.3% and 72.8% of flies dead at 36 hours, and 83.5%, 84.9% and 97.7% of flies dead at 72 hours, respectively.