Samples Six TMAs with one containing nine kinds of important human organs including their RAD001 malignant tumor, tumor-adjacent tissues and normal tissues, and the others containing five kinds of frequent human epithelia carcinoma were involved in this study (Cybrdi Inc., Shaanxi, China). Table 1 and 2 listed detailed information of the tissues presented on the slides. Table 1 Expression of APMCF1 in normal and malignant human tissues Tissue type Sample size Score Liver        carcinoma tissues 2 +++/+++    tumor-adjacent tissues 2 ++/++    normal tissues 2 ++/+ Lung        carcinoma tissues 2 +++/+++    tumor-adjacent tissues 2 +/+    normal tissues

2 +/+ Breast        carcinoma tissues 2 ++/+++    tumor-adjacent tissues 2 ++/+    normal tissues 2 +/- Stomach        carcinoma tissues 2 ++/++    tumor-adjacent tissues 2 +/-    normal tissues 2 -/- Colon        carcinoma tissues 2 +++/+++    tumor-adjacent tissues 2 +/+    normal tissues 2 ++/- Ovary        carcinoma tissues 2 -/-    tumor-adjacent tissues 2 -/-    normal tissues 2 -/- Esophagus        carcinoma tissues

2 +++/+++    tumor-adjacent tissues 2 ++/+++    normal tissues 2 +/+ Brain        glioma tissues 2 -/-    tumor-adjacent tissues 2 +/-    normal tissues 2 +/+ Testis        seminoma tissues 2 ++/+    tumor-adjacent tissues 2 +/-    normal tissues 2 +/- As indicated in the Methods section, APMCF1 immunolabeling was scored as follows: weak immunolabeling (+), moderate immunolabeling (++), strong immunolabeling (+++), and no immunolabeling (-). Table 2 Expression of APMCF1 in human STA-9090 carcinomas Tissue type Sample

size Positive Positive frequency AZD1480 trial (%) Colon carcinoma 55 44 80 Esophageal carcinoma 53 30 57 Lung carcinoma 57 33 58 Hepatic carcinoma 53 51 96 Breast carcinoma 47 16 34 Cell culture Immortalized monkey kidney COS-7 cells were stocked in our lab. Cells were cultured in DMEM medium containing 10% fetal Vasopressin Receptor bovine serum, 50 IU/ml penicillin and 50 μg/ml gentamycin at 37°C under an atmosphere of 5% CO2. Plasmids The entire APMCF1 coding region was amplified by PCR, using upstream and downstream primers which introduce a Hind III and Sal I site respectively according to the conjunct sequence. APMCF1 PCR primers were designed as follows: sense 5′ ATAAGCTTCCATGGCTTCCG 3′; antisense 5′ ACGCGTCGACCTGCCTCTCAGGCAAT 3′. pGEM-APMCF1 constructed by our lab previously [3] was used as templates for PCR amplification. PCR products were digested with Hind III and Sal I, and subcloned into pEGFP-C1, resulting in pEGFP-C1-APMCF1 to express APMCF1 protein fused to GFP. The recombinant plasmid was confirmed by Hind III and Sal I digestion and sequencing. Gene transfection COS-7 cells which were seeded on glass cover-slips in 6 cm plates were cultured in DMEM medium containing 10% fetal bovine serum, and transiently transfected with the plasmid at 50–70% confluence using lipofectmin2000 reagent according to manufacturer instructions.