strain PCC 7120 – hupW RT-Reaction         hupW- antisense NB HupW- AR TGC TGT AGG CGT AAT CAT CG     Subsequenct PCR         hupW-antisense Alr1422-23 R TTT GTA AGC GTT GAG CGA TG Alr1422-23 L 490 Alr1422-sense Alr1422-23 L ACC GAA CTC CGC AGA AAC TA Alr1422-23 R 490 5′RACE         cDNA synthesis selleck compound ALR1423

RACE 1b GTT CCG AAC CAG TGG AAC TC     1 st PCR ALR1423 RACE 2 TTT GTA AGC GTT GAG CGA TG     2 nd PCR ALR1423 RACE 3 GAG ATT TCC GCA ACC GAT AA     Nostoc sp. strain PCC 7120 – alr1422 5′RACE         cDNA synthesis 5-1422-1 CCTAAAGTCGGTGGAAAATCGGC     1 st PCR 5-1422-2 TTCTTCCGTGACAAATCGTG     2 nd PCR 5-1422-3 TTTTTGATGGACGGATGACA     Nostoc sp. strain PCC 7120 – hoxW Northern blot, probe         hoxW-antisense NB HoxW A R AAA GCG ATC GCC TAT TTC AA HoxW L 316 hoxW-sense HoxW L AGG ACA ACG GAT AGC GAA TG NB HoxW A R 316 5′RACE         cDNA synthesis 5′RACE-1 HoxW/A CAC AGC ACG ACG AAC Napabucasin nmr AAG GCT CCA ACT TCA AAC CA     1 st PCR-TAG 5′RACE-TAG Hox/A CAC AGC ACG ACG AAC AAG G 5′RACE-polyG Hox/A   1 st PCR-PolyG 5′RACE-polyG Hox/A CAC AGC ACG ACG AAC AAG GGG GGG GGG GG 5′RACE-TAG Hox/A   Transcriptional studies

cDNA for transcriptional studies by RT-PCR were produced from RNA from N2-fixing and non N2-fixing cultures by using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas) containing RevertAid™ H

Minus M-MuLV Reverse Transcriptase and RiboLock™ Ribonuclease Inhibitor according to the instructions. The following PCRs were done using TAQ polymeras (Fermentas) according to manufacturers instructions and visualized on a 1% agaros gel. The probe used for Northern blot was produced by PCR amplification with appropriate primers (Table 1) and purified with the GFX, PCR, DNA and Gel Band Purification Kit (GE Healthcare). 7 μg of total RNA from N2-fixing and non N2-fixing cultures of Nostoc PCC 7120 and Nostoc punctiforme was separated by electrophoresis Dynein in denaturing agarose gels and blotted to Hybond-N+ (GE Healthcare) according to instruction using the, in the instruction described, modified Church and Gilbert buffer. Labelling of the probes was done using the Rediprime II Random prime labelling system (GE Healthcare) and removing of unincorporated 32P dCTP was thereafter performed by using Probe Quant G-50 microcolumns (GE Healthcare). The equal loading of the RNA was analyzed by the relative amount of rnpB transcripts.