Perithecia plus minusve inter se coniuncta, globosa vel ovoidea, a candida, pulverulenta trama circumfusa, minuta, 0.15–0.25(−0.3) Akt inhibitor μm diametro; ostiola 3–4 sulcata. Asci octospori, clavati, longe stipitati, parte sporifera 35–55(−60) × 7–9 μm. Ascosporae allantoideae, subhyalinae vel flavescentes,

8–10(−11) × 2–2.5 μm. Coloniae roseae, ad canum vergentes et crebra pycnidia conficientes. Conidia fili instar 16–22(−25) × 1.5–2 μm. Stromata in bark: elevating the periderm surface (swollen appearance), which become ripped off by the emerging, non-prominent ostioles; stromata in wood: rather eutypoid, blackening and raising the wood surface. Perithecia more or less in contact, round to ovoid, surrounded by white, powdery entostromatic tissue, minute, 0.15–0.25(−0.3) mm diam; ostioles 3–4 sulcate. Asci 8-spored, clavate, long-stipitate, p. sp. 35–55(−60) × 7–9 μm. Ascospores allantoid, subhyaline selleck inhibitor to light yellow, 8–10(−11) × 2−2.5 μm. Colonies light pink, turning grey and forming numerous pycnidia with age. Conidia filiform 16−22(−25) × 1.5−2 μm. Hosts. Citrus paradisi (Australia, NSW), Vitis vinifera (Australia,

NSW; USA, CA), Ulmus procera (Australia, SA). Notes. This fungus differs from all Eutypella species recognized by Rappaz (1987) mostly due to its smaller perithecia (commonly <250 μm). This fungus is also distinctive Demeclocycline as a result of the light pink coloration of colonies when grown on PDA and PDA-tet. Specimens examined. AUSTRALIA, NSW, Hunter Valley, on dead branches of Citrus paradisi, Dec. 2008, HOLOTYPE: F. P. Trouillas, coll. number HVGRF02, DAR81039, CBS128336; on dead branches of Vitis vinifera, Dec. 2008, ISOTYPE: F. P. Trouillas, coll. number HVVIT05, DAR81040, CBS128337. Discussion Phylogenetic analyses of both the ITS regions of the rDNA and partial sequence of the β-tubulin gene identified 12 diatrypaceous

species from various woody host plants in Australia (shown in bold in Figs. 1 and 2), including the recently described D. brunneospora and E. australiensis (Trouillas et al. 2010a, b). Comparison with reference sequences obtained from GenBank facilitated the identification of C. ampelina, E. leptoplaca, and a Cryptosphaeria sp. isolated from cankers on Populus spp. in NSW and closely related to Cryptosphaeria lignyota (Fr.) Auersw. All the remaining species reported from this study were identified based on morphology. E. leptoplaca is reported from Fraxinus angustifolia, Schinus molle var. areira and Populus spp., although we failed to isolate the pathogen from grapevine despite the existence of previous records from this host in California (Trouillas and Gubler 2004). The occurrence of E. lata on naturalized and ornamental plant species in close to vineyards was confirmed.

ACS Nano 2010, 4:1921–1926.CrossRef 18. Luo S, Shi Q, Zha Z, Yao P, Lin H, Liu N, Wu H, Jin H, Cai J: Morphology and mechanics of chondroid cells from human adipose-derived stem cells detected by atomic force microscopy. Mol Cell Biochem 2012, 365:223–231.CrossRef 19. Malicev E, Kregar-Velikonja N, Barlic

A, Alibegović A, Drobnic M: Comparison of articular and auricular cartilage as a cell source for the autologous chondrocyte implantation. J Orthop Res 2009, 27:943–948.CrossRef 20. Laney DE, Garcia RA, Parsons SM, Hansma HG: Changes in the elastic https://www.selleckchem.com/products/pf-03084014-pf-3084014.html properties of cholinergic synaptic vesicles as measured by atomic force microscopy. Biophys J 1997, 72:806–813.CrossRef 21. Liang X, Mao G, Simon Ng KY: Probing small unilamellar EggPC vesicles on mica surface by atomic force microscopy. Colloids Surf B Biointerfaces 2004, 34:41–51.CrossRef 22. Binnig G, Quate CF, Cerber C: Atomic force microscope. Phys Rev Lett 1986, 56:930–933.CrossRef 23. Darling EM, Topel M, Zauscher S, Vail TP, Guilak F: Viscoelastic properties of human mesenchymally derived stem cells and primary osteoblasts, chondrocytes, and adipocytes. J Biomech 2008, 41:454–464.CrossRef 24. Dammer U, Popescu O, Wagner P, Anselmetti D, Güntherodt HJ, Misevic GN: Binding strength between cell adhesion proteoglycans measured by atomic force microscopy. Science 1995, 267:1173–1175.CrossRef Vorinostat 25.

Brammer KS, Oh S, Cobb CJ, Bjursten LM, van der Heyde H, Jin S: Improved bone-forming functionality on diameter-controlled TiO(2) nanotube surface. Acta Biomater 2009, 5:3215–3223.CrossRef 26. Lee JW, Qi WN, Scully SP: The involvement of beta1 integrin in the modulation by collagen of chondrocyte-response to transforming growth factor-beta1. J Orthop Res 2002, 20:66–75.CrossRef 27. Kurtis MS, Schmidt TA, Bugbee WD, Loeser RF, Sah RL: Integrin-mediated adhesion of human articular chondrocytes to cartilage. Arthritis Rheum 2003, 48:110–118.CrossRef 28. Geiger B, Bershadsky A, Pankov R, Yamada KM: Transmembrane crosstalk between the extracellular matrix–cytoskeleton

crosstalk. Nat Rev Mol Cell Biol 2001, 2:793–805.CrossRef 29. Shakibaei M, Csaki C, Mobasheri A: Diverse roles of integrin receptors in articular cartilage. Phloretin Adv Anat Embryol Cell Biol 2008, 197:1–60.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions SML, QPS and SYS carried out the fabrication of samples and the AFM and LCSM measurements and drafted the manuscript. YP and HSL carried out the immunoassays. NL and HW performed the molecular genetic studies and participated in the sequence alignment. ZGZ and JYC initiated, planned, and controlled the research process. All authors read and approved the final manuscript.”
“Background Nanostructured ZnO thin films required a controlled fabrication process for many applications based on semiconductor devices.

This was similar for SGII salivary spacers (45% persistent in Subject #1, 65% in Subject #2, 51% in Subject #3, and 58% in Subject #4) (Additional file BAY 80-6946 nmr 2: Figure S3 and Additional file 1: Table S4). There was a smaller yet similar group of spacers on the skin of each subject for SGI spacers (38% in Subject #1, 36% in Subject #2, 15% in Subject #3, and 24% in Subject #4) and SGII spacers (39% in Subject #1, 28% in Subject #2, 10% in Subject #3, and 36% in Subject #4) persisting throughout the study. Many of the conserved spacers in saliva matched spacers on the skin of each subject for SGI spacers (44% in Subject #1, 41% in Subject #2,

11% in Subject #3, and 25% in Subject #4) and SGII spacers (42% in Subject #1, 30% in Subject #2, 17% in Subject #3, and 37% in Subject #4). Figure 1 Heatmaps of SGI CRISPR spacer groups in all subjects. Each row represents a unique spacer group and the columns represent each

individual time point. Each day is listed, where M represents morning, N represents noon, and E represents evening. Saliva-derived SGI CRISPR spacer groups are demonstrated on the left, and skin-derived CRISPR spacer groups are on the right of each panel. The intensity scale bar is located to the right, and represents the percentage of total spacers found at each time point in each subject. Panel A – Subject #1, Panel B – Subject #2, Panel C – Subject #3, and Panel D – Subject #4. Figure 2 SGI CRISPR spacer Selleck Anlotinib group heat matrices from all subjects. Each matrix demonstrates the percentage

of shared SGI CRISPR spacer groups between all time points within each subject. The top triangular portion of each matrix represents comparisons between saliva-derived CRISPR spacers, the bottom rectangular portion of each matrix represents comparisons between saliva-derived and skin-derived CRISPR spacers, and the bottom triangular portion of each matrix represents comparisons between skin-derived CRISPR spacers. The intensity scale bar is located to the right of each matrix. Panel GNAT2 A – Subject #1, Panel B – Subject #2, Panel C – Subject #3, and Panel D – Subject #4. We measured the relative conservation of SGII and SGI spacers by time of day sampled to determine whether there were biases in CRISPR spacer profiles on the skin and in the saliva based on sampling times. We found that in the saliva, there was significantly greater conservation (p < 0.05) of CRISPR spacer profiles in the AM for both SGII (Figure 3, Panel A) and SGI spacers (Panel B). Similar conservation of CRISPR spacer profiles were not found for Noon and PM time points for either SGII or SGI spacers in saliva (Additional file 2: Figures S4 and S5).

In each experiment the mice were divided into two groups with one group receiving doxycycline in their drinking water one day after tumor implantation. Mice were sacrificed when moribund and tumors, draining lymph nodes, lungs and pancreases removed for measurements and assessment of metastatic disease. One of the mice given doxycycline in the first experiment and two from the control group in the second experiment

died shortly after tumor implantation and therefore were excluded from this analysis. Tumors grew in all mice irrespective of whether they received doxycycline in their selleck drinking water. However, Fig. 3b demonstrates that tumors excised from doxycycline-treated mice weighed less (left panel) and were smaller in size (right panel) than tumors excised from control animals. As expected, all control mice had metastases in draining periaortic lymph

nodes as well as metastases in their lung in the majority of mice. A smaller subset also had disseminated disease to the pancreas (panel C). In contrast, treated mice had reduced frequency of metastasis to lymph nodes MDV3100 chemical structure and lungs with no metastases to the pancreas. These data suggest that even limited and transient expression of CCL21 in TRAMP TME suppresses primary tumor growth as well as metastatic disease to draining lymph nodes and distant organs. In vivo Tumor Growth is Associated with Methylation of CMV Promoter The data presented above demonstrated that the vast majority of TRAMPC2/TR/CCL21 tumor cells no longer displayed inducible CCL21 induction following orthotopic implantation. Two possibilities mechanisms were next considered to explain this observation: loss of the transgene or alternatively, silencing of

the promoter. To test the first possibility DNA was extracted from TRAMPC2/TR/CCL21-L2 tumor pieces and cloned lines isolated and expanded to generate sufficient DNA for PCR analysis using specific primers to amplify the transfected CCL21 gene. It is apparent from Fig. 4 (panel A) Silibinin that outgrowths obtained from orthotopic TRAMPC2/TR/CCL21 tumors still contained the CCL21 transgene. The absence of a product in the control mouse DNA confirmed that the primers did not amplify endogenous CCL21 gene (lane 9). To test the possibility that the promoter was silenced by methylation, we evaluated the methylation pattern of the CMV promoter. DNA isolated from tumor pieces or clonal lines were bisulfite treated and PCR reactions were performed using primers complementary to a region of CMV promoter not containing methylation sites (oligos 1) or a pair of primers complementary to a region of CMV promoter which contains methylation sites (oligos 2).

To our knowledge, only two methods have been reported on the growth of seedless ZnO nanostructures on graphene via low-temperature liquid phase method. The term ‘seedless’ refers to the omission of pre-deposition of the ZnO seed layer by other processes and metal catalysts. Kim et al. reported the growth of ZnO nanorods on graphene without any seed layer by hydrothermal method, but the obtained results show low density of nanostructures [15]. Xu et al. reported the seedless growth of ZnO nanotubes

and nanorods on graphene by electrochemical deposition [28, 29]. They reported the growth of highly dense ZnO nanostructures by using solely zinc nitrate as the electrolyte with the JQ-EZ-05 datasheet introduction of oxidation process of graphene prior to actual growth. They also find more reported that the diameter, length, and morphology of the nanostructures showed significant dependencies on the growth parameters such as current density, precursor concentration, and growth time. Several other reports also indicated that current density plays an important role in inducing the growth of ZnO nanostructures on the seedless substrate [30, 31]. Recently, Aziz et al. reported the electrodeposition of highly dense ZnO nanorods on single-layer (SL) graphene [30]. Furthermore, the distance between the electrodes and the molarity of electrolyte are also able to give significant effects

on the properties of the resulting nanostructures [32]. Generally, a change in distance between the two electrodes can change the rate of the electrolysis reaction due to the change in the level of current density. The shorter the distance between the electrodes, the higher the electric field and thus the higher current density will be applied [32]. In this paper, we report Unoprostone the seedless growth of highly dense ZnO flower-shaped structures on multilayer (ML) graphene by a single-step cathodic electrochemical deposition method. Methods Figure 1a shows the schematic of chemical vapor deposition (CVD)-grown ML graphene on a SiO2/Si substrate (Graphene Laboratories Inc., Calverton, NY, USA). The Nomarski optical image of ML graphene in Figure 1b

shows the visibility of graphene sheets on the SiO2/Si substrate with different numbers of layers [33] which is consistent with the measured Raman spectra shown in Figure 1c. Ferrari et al. reported that the two-dimensional (2D) peaks which occur at approximately 2,700 cm−1 for bulk graphite have much broader and upshifted 2D band which can be correlated to few-layer graphene [34]. Figure 1 CVD-grown ML graphene and electrochemical deposition. (a) Schematic of ML graphene substrate, (b) Nomarski image of ML graphene, (c) Raman spectra for as-received ML graphene (the measured regions were identified in the circles), (d) schematic of electrochemical deposition setup, and (e) time chart for electrochemical growth process.

We inserted such a kanamycin marker downstream of araC with the following primers: 5′_araC_yabI_insert AATCAGACAATTGACGGCTTGACGGAGTAGCATAGGGTTTTGTGTAGGCTGGAGCTGCTTC; 3′_araC_yabI_insert GCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCCATATGAATA

TCCTCCTTAGTTCCTAT. The insertion was done in DY330 following the protocol described by [42], verified by PCR and moved to MG1655 by P1 transduction, https://www.selleckchem.com/products/LY2603618-IC-83.html thus generating TB55. TB55 was subsequently used to generate a PCR product that spanned the kanamycin cassette adjacent to araC, araC, the full intergenic region between araC and araB, and 42 basepairs at the 5′ and 3′ -prime ends that were homologous to the upstream and 5′-coding region of ygjD, dnaT ,fldA or ffh. The sequence of the primers was ygjD_insert5′ AGTTTTACATCAACCCGCATTGGTCCTACACTGCGCGGTAATAATGTGCCTGTCAAATGGACG ygjD_insert3′ GCCGGTTTCATCGCAGGAAGTTTCAATACCCAGTACACGCATCGTTTCACTCCATCCAAAAAA dnaT_insert5′ TCCGTGTGTTACTATAAAAGTTATCTCCCTTCTCGTTCATCGAATGTGCC TGTCAAATGGACG dnaTC_insert3′ GTCAATACCAACGACGTCCGGGGTCAAAACTCTGGAAGACATCGTTTCAC

TCCATCCAAAAAA ffh_insert5′ GACGCCTTCATGTTATACTGCGGCAAAATACTGATGATGTGTAATGTGCC TGTCAAATGGACG ffh_insert3′ GCGCAGCGTGCGCGACAAACGATCGGTTAAATTATCAAACATCGTTTCAC TCCATCCAAAAAA fldA_insert5′ TGCCTTTATCCGTGGGCAATTTTCCACCCCCATTTCAATAAGAATGTGCC TGTCAAATGGACG fldA_insert3′ ATTACCGGTGTCGCTGCCGAAAAAGATGCCAGTGATAGCCATCGTTTCAC TCCATCCAAAAAA DY330 cells were grown in LB medium supplemented with 0.2% L-arabinose and made electro- and recombination competent [42], and electroporated with the above described PCR product. After electroporation,

cells selleck chemical were transferred to LB medium containing 0.1% L-arabinose and incubated at 32° for 1.5 hours prior to plating on LB plates agar containing L-arabinose (0.1%) and kanamycin (50 μg/ml, Sigma). Clones were checked on LB agar plates supplemented with 0.4% glucose to confirm that they were unable to grow in the presence of glucose. The promoter fusions and the adjacent araC gene were verified by sequencing with the following primers: araC_FW GCTACTCCGTCAAGCCGTCA; Adenosine triphosphate ygjD_RW GGCAATTGGTCTGGGGAGCA. dnaTC_RW AGAGTTGATCGTCCAGAGCG ffh_RW ATTTTGACGAACTCCTGCCC fldA_RW CGAGAGTCGGGAAGAAGTCA The constructs were then moved by P1 transduction into MG1655. To construct TB80 the kanamycin cassette was removed with pCP20. The knockout ΔrelA::kan was derived from the KEIO library clone JW2755 [2] and P1-transduced into TB82. ΔspoT::kan was introduced using AB1058) as donor strain for P1 transduction. To measure activity of the promoters Para, Prsd and Papt, MG1655 and TB80 were transformed [37] with plasmids that contain transcriptional promoter-gfp fusions [29]. Microscopy LB agar pads were prepared by filling a cavity of a sterile microscope cavity slide with a drop of freshly melted LB agar, and covering it with a cover slip to attain a flat surface. The cavity slide was transferred to a fridge for a short time to allow the agar to solidify.

Small increases in sea expression were found in the transitional phase at pH 7.0 and

6.5. However, relative sea expression in the transitional phase at pH 6.0 (n = 2) and 5.5 (n = 3) were high, nine and four times higher, respectively, than in the exponential growth phase. At pH 5.5, extended sea mRNA expression was observed with the peak associated with the transitional phase. However, sea mRNA was not possible to detect selleck products at pH 5.0 or 4.5. Figure 1 Growth and relative sea levels of S. aureus Mu50 when grown at different pH levels. (A) Growth curves determined by OD measurements at 620 nm at pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5. (B) Relative expression (RE) of sea at pH 7.0, 6.5, 6.0, and 5.5. Solid and dashed lines represent growth and RE, respectively. For pH 6.0 and 5.5, the mean and standard deviations of independent batch cultures; two and three, respectively, is displayed. Extracellular SEA was detected in all cultivations of S. aureus Mu50 and the levels increased over time at tested

pH levels allowing growth (Figure 2). The SEA levels increased from pH 7.0 to 6.0 and decreased significantly at lower pH levels, i.e. pH 5.5, 5.0 and 4.5. The specific extracellular SEA concentrations (i.e. the extracellular SEA concentrations divided by the value of the OD at that point in time) correlating the SEA production to growth, showed the same trend. The specific SEA concentrations were 100, 450, 510, 210, 40, and 870 ng per ml and OD unit for pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5, respectively. The specific SEA concentration at pH 4.5 is misleading since the culture was not growing. Figure 2 SEA levels, growth rate and sea Ixazomib expression of S. aureus Mu50 at different pH levels. Extracellular others SEA levels in the mid-exponential, the transitional, the early stationary, and late stationary growth phase;

maximal growth rate (μmax), and relative sea levels (RE) in the transitional phase. At pH 4.5 the SEA values are after 10, 24 and 30 h of growth, shown in the figure as transitional, early stationary and late stationary phase samples, respectively. The values at pH 6.0 and 5.5 are the average and standard deviations of two and three independent batch cultures, respectively. Phage-associated sea expression Samples of bacterial cells and culture supernatants from S. aureus Mu50 were collected to determine the trends of the relative sea gene copy number (and thus the replicative form of the sea-carrying phage) and relative phage copy number in the four growth phases at different pH values (Figure 3). The relative sea gene copy number was low throughout the cultivations at pH 7.0 and 6.5. The sea gene copy number peaked at pH 5.5, being twelve times higher than at pH 7.0 in the mid-exponential growth phase, and a trend of the sea gene copy number decreasing over time was observed at this pH. The sea gene copy number increased over time at pH 5.0 and 4.

Science 1989,245(4924):1374–1377.PubMedCrossRef 18. Huang HC, He SY, Bauer DW, Collmer A: The Pseudomonas syringae pv . syringae 61 hrpH product, an envelope protein required for elicitation of the hypersensitive response in plants. J Bacteriol 1992,174(21):6878–6885.PubMed 19. Lee J, Klusener B, Tsiamis G, Stevens C, Neyt C, Tampakaki AP, Panopoulos NJ, Noller J, Weiler EW, Cornelis GR, et al.: HrpZ(Psph) from the plant pathogen Pseudomonas syringae pv. phaseolicola binds to lipid bilayers and forms an ion-conducting pore in vitro. Proc Natl Acad Sci USA 2001,98(1):289–294.PubMedCrossRef 20. Preston GM, Bertrand N,

Rainey PB: Type III secretion in plant growth-promoting Pseudomonas fluorescens SBW25. Mol Microbiol 2001,41(5):999–1014.PubMedCrossRef 21. Ma Q, Zhai Y, Schneider JC, Ramseier TM, Saier MH Jr: Protein secretion https://www.selleckchem.com/products/cobimetinib-gdc-0973-rg7420.html systems of Pseudomonas aeruginosa BGB324 solubility dmso and P fluorescens . Biochim Biophys

Acta 2003,1611(1–2):223–233.PubMedCrossRef 22. Rezzonico F, Binder C, Defago G, Moenne-Loccoz Y: The type III secretion system of biocontrol Pseudomonas fluorescens KD targets the phytopathogenic Chromista Pythium ultimum and promotes cucumber protection. Mol Plant Microbe Interact 2005,18(9):991–1001.PubMedCrossRef 23. Mazurier SLM, Siblot S, Mougel C, Lemanceau P: Distribution and diversity of type III secretion system-like genes in saprophytic and phytopathogenic fluorecent Pseudomonas . FEMS Microbiology Ecology 2004, 49:455–467.PubMedCrossRef 24. Toussaint B, Delic-Attree I, Vignais PM: Pseudomonas aeruginosa contains an IHF-like protein that binds to the algD promoter. Biochem Biophys Res Commun 1993,196(1):416–421.PubMedCrossRef 25. Dacheux D, Goure J, Chabert J, Usson Y, Attree I: Pore-forming activity of type III system-secreted proteins leads to oncosis of Pseudomonas aeruginosa -infected macrophages. Mol Microbiol 2001,40(1):76–85.PubMedCrossRef 26. Broek D, Chin AWTF, Bloemberg GV, Lugtenberg Cell press BJ: Molecular nature of spontaneous modifications

in gacS which cause colony phase variation in Pseudomonas sp . strain PCL1171. J Bacteriol 2005,187(2):593–600.PubMedCrossRef 27. Hakansson S, Schesser K, Persson C, Galyov EE, Rosqvist R, Homble F, Wolf-Watz H: The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. Embo J 1996,15(21):5812–5823.PubMed 28. Clerc P, Baudry B, Sansonetti PJ: Plasmid-mediated contact haemolytic activity in Shigella species: correlation with penetration into HeLa cells. Ann Inst Pasteur Microbiol 1986,137A(3):267–278.PubMedCrossRef 29. Shaw RK, Daniell S, Ebel F, Frankel G, Knutton S: EspA filament-mediated protein translocation into red blood cells. Cell Microbiol 2001,3(4):213–222.PubMedCrossRef 30.

Conclusion This paper demonstrates this website a hot-rolling process to achieve silver nanowire transparent electrodes

with a smooth surface topology and excellent nanowire adhesion to the substrate. An RMS surface roughness of 7 nm was achieved, with a maximum peak-to-valley height of 30 nm. These values meet the smoothness requirements needed for most organic devices. The silver nanowires were successfully embedded in the substrate such that their sheet resistance changed less than 1% after the tape test. This report shows that the surface roughness issue for nanowire electrodes can be easily addressed in a roll-to-roll compatible process without using any additional materials. Acknowledgements This work was supported by the Natural Science and Engineering Research Council (NSERC) of Canada. References 1. Pang S, Hernandez Y, Feng X, Müllen K: Graphene as transparent AZD1152-HQPA mw electrode material for organic electronics. Adv Mater 2011, 23:2779–2795. 10.1002/adma.20110030421520463CrossRef 2. Dan B, Irvin GC, Pasquali M: Continuous and scalable fabrication of transparent conducting carbon nanotube films. ACS Nano 2009,

3:835–843. 10.1021/nn800830719354279CrossRef 3. Hecht DS, Heintz AM, Lee R, Hu L, Moore B, Cucksey C, Risser S: High conductivity transparent carbon nanotube films deposited from superacid. Nanotechnology 2011, 22:075201. 10.1088/0957-4484/22/7/07520121233544CrossRef 4. Rathmell AR, Wiley BJ: The synthesis and coating of long, thin copper nanowires to make flexible, transparent conducting films on plastic substrates. Adv Mater 2011, 23:4798–4803. 10.1002/adma.20110228421953576CrossRef 5. Rathmell AR, Bergin SM, Hua Y-L, Li Z-Y, Wiley BJ: The growth mechanism of copper nanowires and their properties in flexible, transparent conducting films. Adv Mater 2010, 22:3558–3563. 10.1002/adma.20100077520512817CrossRef

6. Madaria AR, Kumar A, Zhou C: Large scale, highly conductive and patterned transparent films of silver nanowires on arbitrary substrates and their application in touch screens. Nanotechnology 2011, 22:245201. 10.1088/0957-4484/22/24/24520121508460CrossRef 7. Hu L, Kim HS, Lee J-Y, Peumans P, Cui Y: Scalable coating and properties of transparent, flexible, silver nanowire electrodes. Calpain ACS Nano 2010, 4:2955–2963. 10.1021/nn100523220426409CrossRef 8. Liu C-H, Yu X: Silver nanowire-based transparent, flexible, and conductive thin film. Nanoscale Res Lett 2011, 6:75. 10.1186/1556-276X-6-75321222321711602CrossRef 9. Kumar A, Zhou C: The race to replace tin-doped indium oxide: which material will win? ACS Nano 2010, 4:11–14. 10.1021/nn901903b20099909CrossRef 10. Hecht DS, Hu L, Irvin G: Emerging transparent electrodes based on thin films of carbon nanotubes, graphene, and metallic nanostructures. Adv Mater 2011, 23:1482–1513. 10.1002/adma.20100318821322065CrossRef 11.

Methods Experimental The investigated samples were produced by thermal evaporation of Cerac learn more Inc., Milwaukee, WI, USA, silicon monooxide SiО with 99.9% purity in vacuum (the residual pressure (1…2)∙10−3 Pa). During glance angle-SiО deposition, the substrate (polished Si wafer) was oriented at the angle α = 75° between the normal to the substrate surface and the direction to the evaporator. The thickness of oblique deposited films was chosen with the range 400…600 nm. Because of additional oxidation by residual gases during evaporation of SiO, the compositionally

non-stoichiometric SiO x (x ~ 1.5) films were deposited in the vacuum chamber. After their deposition, the porous SiO x films were annealed in the vacuum chamber at 975°C for 15 min to grow ncs-Si. The structure of obliquely deposited SiO x films was studied by SEM apparatus (ZEISS EVO 50XVP, Oberkochen, Germany). In Figure 1a, the cross-sectional view of SiO x film oblique deposited on silicon wafer is shown. As can be seen in the figure, the investigated SiO x films have a porous inclined pillar-like structure with the pillar diameters see more of 10 to 100 nm. The porosity of films depends on the angle of deposition and equals to 53% for α = 75°. High-temperature annealing of these films does not change the porosity and pillar-like structure of the

samples [12].

Figure 1 Cross-section view and AFM topology. (a) SEM micrograph of SiO x film cross-section and (b) AFM topology of the surface of 5 nm gold film annealed at 450°C. The obtained nc-Si-SiO x structures were passivated in the HF vapor, which results TCL in the enhancement of the PL intensity by approximately 200 times [13]. Thin Au layers were deposited on one part of the passivated nc-Si-SiO x structures by thermal evaporation and then annealed at 450°C in vacuum. The mass thickness of the Au layers was about 5 nm. Studying topology of the Au layers was carried out with an atomic force microscope (AFM) NanoScope IIIa (produced by Digital Instrument, Tonawanda, NY, USA). An axonometric AFM image of the Au layer surface is presented in Figure 1b. One can see that the Au layer is semicontinuous and consists of nanoislands. The photoluminescence spectra were recorded at room temperature using a system based on a ZMR-2 monochromator equipped by a photomultiplier tube and detection system. The PL spectra were normalized to the spectral sensitivity of the experimental system. The PL signal was excited by radiation of a N2 laser at the wavelength 337 nm. The excitation and detection of PL emission was carried out through the front side of samples. In PL spectra, we took into account the transmittance of exciting light and PL emission through an Au film.