PubMedCrossRef 13. Dorer MS, Isberg RR: Non-vertebrate hosts in the analysis of host-pathogen interactions. Microbes Infect 2006, 8:1637–1646.PubMedCrossRef 14. Steinert M, Leippe M, Roeder T: Surrogate hosts: protozoa and invertebrates as models for studying pathogen-host interactions. Int J Med Microbiol check details 2003, 293:321–332.PubMedCrossRef 15. Schell MA, Lipscomb L, DeShazer D: Comparative genomics and an insect model rapidly identify novel virulence genes of Burkholderia mallei. J Bacteriol 2008,190(7):2306–2313.PubMedCrossRef 16. Wand

ME, Müller CM, Titball RW, Michell SL: Macrophage and Galleria mellonella infection models reflect the virulence of naturally occurring isolates of B. pseudomallei, B. thailandensis and B. oklahomensis. BMC Microbiol 2011, 11:11.PubMedCrossRef 17. Hasselbring BM, Patel MK, Schell MA: Dictyostelium discoideum as a model system for identification of Burkholderia pseudomallei virulence factors. Infect Everolimus cell line Immun 2011,79(5):2079–2088.PubMedCrossRef 18. Gan YH, Chua KL, Chua HH, Liu B, Hii CS, Chong HL, Tan P: Characterization of Burkholderia pseudomallei infection

and identification of novel virulence factors using a Caenorhabditis elegans host system. Mol Microbiol 2002,44(5):1185–1197.PubMedCrossRef 19. Lee SH, Ooi SK, Mahadi NM, Tan MW, Nathan S: Complete killing of Caenorhabditis elegans by Burkholderia pseudomallei is dependent on prolonged direct association with the viable pathogen. PLoS One 2011,6(3):e16707.PubMedCrossRef 20. O’Quinn AL, Wiegand EM, Jeddeloh JA: Pregnenolone Burkholderia pseudomallei kills the nematode Caenorhabditis elegans using an endotoxin-mediated paralysis. Cell Microbiol 2001,3(6):381–393.PubMedCrossRef 21. Lee YH, Chen Y, Ouyang X, Gan YH: Identification of tomato plant as a novel host model for Burkholderia pseudomallei. BMC Microbiol 2010.,10(28): 22. Kavanagh K, Reeves EP: Insect and mammalian innate immune responses are much alike. Microbe 2007,2(12):596–599. 23. Sifri

CD, Ausubel FM: Use of simple non-vertebrate hosts to model mammalian pathogenesis. In Cellular Microbiology. Second edition. Edited by: Cossart P, Boquet P, Normark S, Rappuoli R. ASM Press, Washington, D.C; 2004:543–563. 24. Lavine MD, Strand MR: Insect hemocytes and their role in immunity. Insect Biochem Mol Biol 2002,32(10):1295–1309.PubMedCrossRef 25. Schell MA, Ulrich RL, Ribot WJ, Brueggemann EE, Hines HB, Chen D, Lipscomb L, Kim HS, Mrázek J, Nierman WC, et al.: Type VI secretion is a major virulence determinant in Burkholderia mallei. Mol Microbiol 2007,64(6):1466–1485.PubMedCrossRef 26. Pukatzki S, McAuley SB, Miyata ST: The type VI secretion system: translocation of effectors and effector-domains. Curr Opin Microbiol 2009,12(1):11–17.PubMedCrossRef 27. Schwarz S, West TE, Boyer F, Chiang WC, Carl MA, Hood RD, Rohmer L, Tolker-Nielsen T, Skerrett SJ, Mougous JD: Burkholderia type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions.

Firstly, we performed a stepwise digitonin extraction of intact epimastigote cells. The pattern of Tc38 extraction was compared with those of cytosolic (PK), mitochondrial (CS), and glycosomal (HK) markers (Figure 3A). The Tc38 extraction curve clearly follows that of CS. It begins to be extracted at a digitonin concentration of 2.0 mg/mL, and at 5 mg/mL 39% of the protein still remained in the pellet. This pattern supports the hypothesis of a predominant mitochondrial localization of Tc38 in the cell.

Figure 3 Subcellular localization of Tc38 using biochemical approaches in T. cruzi I-BET-762 ic50 epimastigotes. (A) Digitonin extraction. Epimastigotes (125 mg per tube) were incubated with different digitonin concentrations (indicated on the abscissa) as described in Materials and Methods. Marker enzymes activities: hexokinase

(HK), citrate synthase (CS), and pyruvate kinase (PK). The amounts of Tc38 were determined by western analysis. (B) Subcellular fractionation. The experiment was carried out Afatinib ic50 using 3.3 g (wet weight) of parasites. Fractions are plotted in the order of their isolation, from left to right: nuclear (N), large granule (G), small granule (SG), microsomal (M) and supernatant (S). The ordinate represents relative specific activity (percentage of total activity/percentage of total protein). The abscissa indicates the cumulative protein content. The percentage of recovery for the marker enzymes: citrate synthase 70.9%, hexokinase 74.1%, tuclazepam cytochrome C reductase 43.6%, pyruvate kinase 85.3%, Tc38 61.1%. Error bars indicate the variation in band intensity seen by quantification of the western blot. Secondly, we

carried out subcellular fractionation experiments. They also showed that Tc38 is a mitochondrial protein since the highest specific activity was observed in the large granular fraction (Figure 3B). The recovery of CS activity in the nuclear fraction suggests a contamination of this fraction with mitochondrial proteins. Tc38 presents a complex pattern of distribution within the mitochondrion In order to address the subcellular localization of Tc38 with another approach we performed immunohistochemistry. The analysis of asynchronous epimastigote cultures showed a non-homogeneous Tc38 pattern (Figure 4). Parasites exhibit a widespread dotted distribution in an area that resembles the branched shape of the mitochondrion. In addition, 75.8 ± 0.5% (n = 500) cells present a strong Tc38 staining on the kinetoplast. As commonly seen in epimastigotes, DAPI brightly stains the “”disk”" shaped kinetoplast DNA and produces a weak signal in the rounded nuclear DNA. Although control experiments using nuclear protein antibodies verified the penetration of the antibodies into the nucleus (data not shown), we were unable to detect any consistent nuclear fluorescence from Tc38 in these preparations. Figure 4 Subcellular localization of Tc38 using immunohistochemical approaches in asynchronous cultures of T.

CrossRef 22. Zhang J, Fu Y, Lakowicz JR: Enhanced Förster resonance energy transfer (FRET) on a single metal particle. J Phys Chem C 2006, 111:50–56.CrossRef 23. Xie HY, Chung HY, Leung PT, Tsai DP: Plasmonic enhancement of Förster energy transfer between two molecules in the vicinity of a metallic nanoparticle: nonlocal optical effects. Phys Rev B 2009, 80:155448.CrossRef click here 24. Chung H, Leung P, Tsai D: Enhanced intermolecular energy transfer in the vicinity of a plasmonic nanorice. Plasmonics 2010, 5:363–368.CrossRef 25. Zhao L, Ming T, Shao L, Chen H, Wang J: Plasmon-controlled Förster resonance energy transfer. J Phys Chem C 2012, 116:8287–8296.CrossRef 26. Martín-Cano D, González-Tudela A, Martín-Moreno L, García-Vidal FJ, Tejedor

C, Moreno E: Dissipation-driven generation of two-qubit entanglement mediated by plasmonic waveguides. Phys Rev B 2011, 84:235306.CrossRef 27. Chen W, Chen Fluorouracil G-Y, Chen Y-N: Coherent transport of nanowire

surface plasmons coupled to quantum dots. Opt Express 2010, 18:10360–10368.CrossRef 28. Cheng M-T, Luo Y-Q, Song Y-Y, Zhao G-X: Plasmonic waveguides mediated energy transfer between two distant quantum dots. J Mod Opt 2010, 57:2177–2181.CrossRef 29. Chen G-Y, Lambert N, Chou C-H, Chen Y-N, Nori F: Surface plasmons in a metal nanowire coupled to colloidal quantum dots: scattering properties and quantum entanglement. Phys Rev B 2011, 84:045310.CrossRef 30. Chen W, Chen G-Y, Chen Y-N: Controlling Fano resonance of nanowire surface plasmons. Opt Lett 2011, 36:3602–3604.CrossRef 31. Ono A, Kato J-I, Kawata S: Subwavelength optical imaging through a metallic nanorod array. Phys Rev Lett 2005, 95:267407.CrossRef 32. Novotny L, Hecht B: Principles of Nano-Optics. Cambridge: Cambridge University Press; 2006.CrossRef 33.

Dung HT, Knöll L, Welsch D-G: Intermolecular energy transfer in the presence of dispersing and absorbing media. Phys Rev A 2002, 65:043813.CrossRef 34. Tai CT: Dyadic Green Functions in Electromagnetic Theory. New York: IEEE; 1993. 35. Johnson PB, Christy RW: Optical constants of the noble metals. Phys Rev B 1972, 6:4370–4379.CrossRef Acesulfame Potassium Competing interests The authors declare that they have no competing interests. Authors’ contributions YCY was responsible for the theoretical derivation, anticipated the numerical simulations, analyzed the simulation results, proposed the interpretation, and drafted the manuscript. JML performed the numerical simulations. CJJ and XHW conceived of the study and revised the manuscript substantially. All authors read and approved the final manuscript.”
“Background Carbon-derived nanoparticles (NPs) such as single- and multi-walled carbon nanotubes, fullerenes, and graphene are all receiving attention because of their interesting and unusual electronic [1], thermal [2], and mechanical [3] properties. We have recently demonstrated a facile route towards the synthesis of nanosized water-soluble sulfonated graphene sheets (SGSs) that use graphite as the starting material [4].

2 kb NDRG2 gene released from plasmid by Sal I—Hind III restriction enzyme digestion

were shown in Fig. 1A. The target segment in AdEasy-GFP-NDRG2 was detected by PCR. Results of electrophoresis on PCR amplification of the target segment in AdEasy-GFP-NDRG2 are shown in Fig. 1B. Five clones were picked. Titers of the adenoviral stocks were 3.1 × 108 cfu/ml. Figure 1 Validation of recombinant adenovirus. (A) The pET44a-NDRG2 Dabrafenib chemical structure plasmid with and without digestion by by Sal I—Hind III restriction enzyme were shown. (B) The PCR product of target segment in AdEasy-GFP-NDRG2. NDRG2 Inhibits CCRCC cell Proliferation To elucidate the functional role of NDRG2 in renal tumorigenesis, we examined the effect of exogenous expression of NDRG2 on the malignant phenotype of CCRCC cells, A-498. Western blotting revealed that A-498 expressed NDRG2 when infected by recombinant adenovirus pAd-GFP-NDRG2 (Fig. 2A). Figure 2 NDRG2 inhibits the proliferation of CCRCC cells. (A) Tthe protein expression was detected by Western blotting. (B) The proliferation of A-498 cells was detected by MTT.* P < 0.05. We then tested the effect of NDRG2 on the Proliferation of A-498 cells. Growth curves were compared in a medium containing 10% fetal calf serum, the curves for cells expressed NDRG2 was significantly lower than those for control cells(P < 0.05;

Fig. 2B). This suggested that NDRG2 had the potential to inhibit selleck chemical the proliferation of CCRCC cells. NDRG2 Induces the Cell Cycle Arrest and apoptosis of CCRCC Cells To further investigate the mechanism by which NDRG2 inhibits CCRCC cell

growth, we studied the effects of NDRG2 expression on the cell cycle by fluorescence activated cell sorter analysis (FASC). The results of the cell cycle showed that 25.00% of cells expressed NDRG2 were in S-phase compared to 40.67% of control cells, whereas 62.08% of cells expressed NDRG2 were in G1-phase compared to 54.39% of control cells (P < 0.05, Fig. 3A). In addition, FASC also revealed that there were much more apoptotic cells in NDRG2 -expressing cells than in the controls (P < 0.01, Fig. 3B). We then investigated the mechanism by which NDRG2 induced cell cycle arrest in CCRCC cells. Cell cycle effectors were examined by western Selleckchem MK-3475 blot analysis (Fig. 3C). Our results indicated that upregulation of NDRG2 protein was associated with a reduction in cyclin D1, cyclin E proteins, whereas cyclinD2, cyclinD3 and cdk2 were not affected. Figure 3 NDRG2 Induces the Cell Cycle Arrest and apoptosis of CCRCC Cells. (A) and (B) The effects of NDRG2 expression on the cell cycle and apoptosis were detected by FASC. (C) The cell cycle protein were examined by western blot analysis. p53 up-regulates NDRG2 expression in CCRCC cells Bioinformatics analysis suggested that there was a p53 binding site in upstream of NDRG2 promoter. To investigate whether NDRG2 expression was regulated by p53, we first infected A-498 cells with recombinant adenovirus Ad-p53.

The observation demonstrated that local single-crystal LSMO grains can be formed on the sapphire substrate with a sharp heterointerface during thin-film growth. The heterointerface between the LSMO nanolayer and the sapphire substrate is relatively flat and smooth in comparison to the one grown on the In2O3 epitaxy. This is believed to reduce the potential crystal defects at the heterointerface. Moreover, the FFT patterns and HR lattice fringes

revealed that a thin disordered region was formed between the misoriented nanograins (Figure 3b). Figure selleck screening library 3 Cross-sectional TEM morphology of the LSMO nanolayer, FFT patterns, and HR lattice fringes. (a) Low-magnification TEM image of the LSMO nanolayer on the sapphire substrate. The insets show the HRTEM images of LSMO nanolayer on the sapphire with (right) and without (left) sharp interface. (b) HRTEM image taken from the local regions

containing different oriented LSMO nanograins. The corresponding FFT patterns taken from regions 1, 2, and 3 are also shown. Figure 4a,b shows the surface topography of LSMO nanolayers with and without In2O3 epitaxial buffering. Comparatively, with a root-mean-square (rms) roughness of 1.7 nm, the surface of the LSMO nanolayer grown on the bare sapphire substrate was smoother. The rms surface roughness of the film with In2O3 epitaxial buffering is 3.5 nm. As observed from the SEM images, the roughening of the LSMO nanolayer surface grown on the In2O3 epitaxy might C59 wnt datasheet be associated with its irregular grain sizes. Figure 4c,d shows the Non-specific serine/threonine protein kinase spatial distributions of currents at the micro- and/or nano-scale of the LSMO nanolayers with and without In2O3 epitaxy measured at a fixed applied bias during AFM scanning. The LSMO nanolayer current maps show that the dark regions only account for a remarkably small ratio over the area of interest, revealing that the LSMO nanolayer surfaces remain a conductive characteristic under 0.05V. In comparison, the LSMO nanolayer without In2O3 epitaxial buffering

has a homogeneously spatial distribution of current spots over the measured area. The current mean statistic value distributed over the measured area is 30.3 and 38.8 pA for the LSMO nanolayers with and without In2O3 epitaxial buffering, respectively. The LSMO nanolayer with In2O3 epitaxial buffering is slightly more resistant than the film without buffering. Figure 4 AFM and CAFM images of the LSMO nanolayer. AFM images of the LSMO nanolayer (a) with and (b) without In2O3 epitaxial buffering. CAFM images of the LSMO nanolayer (c) with and (d) without In2O3 epitaxial buffering. Figure 5a,b shows the magnetization vs. temperature curves (M-T) for the zero-field-cooled (ZFC) and field-cooled (FC) samples. The applied magnetic field was 1,000 Oe during the M-T measurements. The M-T curves demonstrated that the LSMO nanolayers have a sharp ferromagnetic to paramagnetic transition.

Br J Gen Pract. 2014;64:e1–9.PubMedCrossRef 64. Misurac JM, Knoderer CA, Leiser JD, et al.

Nonsteroidal anti-inflammatory drugs are an important cause of acute kidney injury in children. J Pediatr. 2013;162:1153–9.PubMedCrossRef 65. Iorio ML, Cheerharan M, Kaufman SS, Reece-Stremtan S, Boyajian M. Acute liver failure following cleft palate repair: a case of therapeutic acetaminophen toxicity. Cleft Palate Craniofac J. 2013;50:747–50.PubMedCrossRef 66. Savino F, Lupica MM, Tarasco V, et al. Fulminant hepatitis after 10 days of acetaminophen treatment at recommended dosage in an infant. Pediatrics. 2011;127:e494–7.PubMedCrossRef 67. Ferrajolo C, Capuano A, Verhamme KM, et al. Drug-induced hepatic injury in children: a case/non-case study of suspected adverse drug reactions in VigiBase. Br J Clin Pharmacol. 2010;70:721–8.PubMedCentralPubMedCrossRef 68. Mahadevan SB, McKiernan PJ, Davies P, Kelly DA. Paracetamol Maraviroc nmr PD-0332991 price induced hepatotoxicity. Arch Dis Child. 2013;91:598–603.CrossRef 69. Hon KL, Leung AK. Be careful, mom and doc: hepatotoxicity associated with prescribed medications in young infants. Int J Pediatr. 2009;2009:673269.PubMedCentralPubMedCrossRef 70. Kubic A, Burda AM, Bockewitz E, Wahl M. Hepatotoxicity in an infant following supratherapeutic dosing of acetaminophen for twenty-four hours. Semin Diagn Pathol. 2009;26:7–9.PubMedCrossRef 71. Eyers

S, Fingleton J, Perrin K, Beasley R. Proposed MHRA changes to UK children’s paracetamol dosing recommendations: modelling study. J R Soc Med. 2012;105:263–9.PubMedCentralPubMedCrossRef 72. Eyers S, Fingleton J, Eastwood A, Perrin K, Beasley R. British National Formulary for Children: the risk of inappropriate paracetamol prescribing. Arch Dis Child. 2012;97:279–82.PubMedCrossRef 73. Australian Government Department of Health TGA. Over-the-counter medicines. 2013. http://​www.​tga.​gov.​au/​industry/​otc.​htm#.​U3HyFPldU2s. Accessed May 2014. 74. Volans G, Monaghan J, Colbridge Rucaparib molecular weight M. Ibuprofen overdose.

Int J Clin Pract Suppl. 2003;57:54–60. 75. Hall AH, Smolinske SC, Conrad FL, et al. Ibuprofen overdose: 126 cases. Ann Emerg Med. 1986;15:1308–13.PubMedCrossRef 76. Argentieri J, Morrone K, Pollack Y. Acetaminophen and ibuprofen overdosage. Pediatr Rev. 2012;33:188–9.PubMedCrossRef 77. Varicella, herpes zoster and nonsteroidal anti-inflammatory drugs: serious cutaneous complications. Prescrire Int. 2010;19:72–3. 78. Kramer LC, Richards PA, Thompson AM, Harper DP, Fairchok MP. Alternating antipyretics: antipyretic efficacy of acetaminophen versus acetaminophen alternated with ibuprofen in children. Clin Pediatr (Phila). 2008;47:907–11.CrossRef 79. Paul IM, Sturgis SA, Yang C, et al. Efficacy of standard doses of ibuprofen alone, alternating, and combined with acetaminophen for the treatment of febrile children. Clin Ther. 2010;32:2433–40.PubMedCentralPubMedCrossRef 80. Purssell E.

Louis, MO, USA). 11-Mercaptopropionic acid (MUA) and UDT were of analytical grade and were obtained from Fluka (New South Wales, Australia). All standard chemical Angiogenesis inhibitor solutions

or powders were protected from sunlight and kept at 25°C in a well-ventilated chemical storage cabinet and dry box. Stock solutions of sodium borohydride and l-ascorbic acid were freshly prepared for each new set of experiments. Synthesis and sample fabrication The GNRs (4.23 M) used in this study were synthesized by using the seed-mediated growth method in the presence of silver ions [25]. A 0.01 M MUA solution was prepared by mixing 0.04 g of MUA with 19.96 mL ethanol. A same concentration of UDT solution with MUA was prepared as mentioned above. The as-synthesized GNR was washed and centrifuged (6,000 rpm, 6 min) before 100 μL of MUA/UDT was added (remove excess cetyltrimethylammonium bromide (CTAB) surfactant). The LSPR peak of the samples was remained constant after 3 h of reaction time. Finally, the modified samples were washed before Temsirolimus use to avoid unpredictable interferences from the free carboxylic groups of MUA in solutions. Spectroscopic measurements The morphology of each specimen was verified through TEM analysis (JEOL, JEM-1200EX 2, Akishima, Tokyo, Japan) operating

at 80 kV. A double-beam UV–vis spectrophotometer (JASCO V-670, Easton, MD, USA) with a light path of 10 mm was used to measure the surface

plasmon resonance of GNR. All measurements were performed at room temperature using 10-mm cuvettes. X-ray photoelectron spectroscopy (XPS) measurements were conducted using an ESCA Laboratory Thermo Scientific Theta Probe spectrometer (Waltham, MA, USA) with monochromatic Al Kα radiation (1,486.68 eV). C (1s) peak was used as an internal standard calibration peak at 284.6 eV. PIK3C2G Results and discussion Figure  1a,b shows transmission electron microscopy (TEM) images and a particle size distribution of MUA which illustrates that no physical characteristic dissimilarity was found with as-synthesized GNR upon modification of GNR-MUA. The TEM image does not exhibit any corrosion, aggregation, or other defect (Figure  1a). The particle size analysis was carried out by counting about 100 particles for each specimen. It is estimated that the GNR has an average length of 53.93 ± 3.81 nm and diameter of 16.47 ± 1.76 nm, while the average length of as-synthesized GNR is 56.24 ± 3.47 nm and average diameter is 16.62 ± 1.60 nm (Figure  1b). Figure 1 TEM, size distribution, UV-visible-IR extinction spectra, and functionalized GNR ligand. TEM images of GNR-MUA (a). Size distribution of GNR-MUA (b).

PubMedCentralPubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions The authors’ contributions to this research work are reflected in the order shown. MZ contributed to the majority of experimental works and the writing of the manuscript. YB and WL carried out protein expression and purification. YH and XX participated in virus preparation and their characterization. SC participated in in vivo

neutralization assay. WS and XS directed the research, designed and coordinated the project, analyzed the data, and wrote the manuscript. PC and YZ conceived the study and participated in its design. All authors read and approved the final manuscript.”
“Background The conventional in-vitro assays to measure the titer or potency of live viral-based vaccines are usually based on the infectivity of the vaccine buy Selumetinib virus in cell cultures (plaque assay or CCID50) [1–5]. In both methods, the experiment duration is long due to the time needed for virus replication producing the biological effect. In addition, there is a cell substrate limitation with the traditional methods, and only viruses that cause a detectable biological

effect on infected cells can be evaluated. The introduction of real time PCR technology for the quantitation of viral infectivity has significantly improved viral infectivity assays. This method is a combination of virus propagation Cilomilast manufacturer and quantitative PCR (qPCR) or RT-qPCR. In a study by Ranheim et al., [6] a RT-qPCR assay was developed to detect rotavirus vaccine (Rota Teq) infectivity within two days. In this assay, the confluent Vero cells in 96-well plates were inoculated with

serial dilutions of test samples, a pentavalent reassortant rotavirus reference standard, and assay controls. After 24 hours, Vero cells were lysed and the lysates were measured by RT-qPCR to quantify viral from replication. In another study, Schalk et al., [4] developed a rapid assay for the measurement of infectivity-potency in MMR trivalent vaccines based on a qPCR infectivity assay. The assay was able to demonstrate the potency of mumps and measles viruses within a period of 2 days. Since rubella virus replicates slower than measles and mumps, the potency estimation for rubella virus was PCR-based assays as end-points since a plaque assay for measles and rubella virus usually takes 9 days [4]. This period of time for detection of mumps virus in cell line is 6 days. A one week time reduction in the qPCR infectivity assay without loss of precision compared to a plaque assay and TCID50 was a major advantage of the assay. Dr. Knipe’s group at Harvard Medical School constructed a candidate Herpes Virus vaccine through deletion of the UL5 and UL29 coding regions of HSV-2 virus [7]. The resultant vaccine, HSV529, is being developed by Sanofi Pasteur and is currently under a human phase I clinical trial [8, 9]. The AV529-19 cell line is used for the propagation of HSV529.

Quantitative real-time PCR qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad,USA) on a CFX96 Real-Time Detection System (Bio-Rad, USA). For host gene expression, the thermal cycle conditions were performed as described previously [18]. The expression levels of Drosomycin, Diptericin, and Cecropin A1 at 18 hours post infection in the flies were normalized to the house keeping gene ribosome protein 49 (rp49) [18]. For bacterial gene expression, the expression levels of hla, hlg, sak, sspA, and hysA in different

strains growing in BHI broth GSK-3 inhibitor at mid-log and stationary phases and inside the flies were normalized to the control gene, gyrB, encoding DNA topoisomerase subunit B [19]. All primers used for qRT-PCR are listed in Table 1. Relative target gene expression was calculated according to the ΔΔCt method, in which the fold difference in expression was 2-ΔΔCt[20]. The experiments

were repeated at least three times. Student’s t-test analysis was performed to determine significant differences of the host gene expressions in response to different MRSA strains and the virulence gene expression among different strains. Table 1 Primers used for qRT-PCR analysis Primers Sequence (5′ to 3′) Ref rp49 F GACGCTTCAAGGGACAGTATCTG [18] rp49 R AAACGCGGTTCTGCATGAG [18] dpt- F GCTGCGCAATCGCTTCTACT [18] dpt- R TGGTGGAGTGGGCTTCATG [18] dro-F CGTGAGAACCTTTTCCAATATGATG [18] dro-R TCCCAGGACCACCAGCAT [18] cecA1-F TCTTCGTTTTCGTCGCTCTC [18] cecA1-R GNAT2 CTTGTTGAGCGATTCCCAGT [18] hla-F CTGATTACTATCCAAGAAATTCGATTG This study hla-R CTTTCCAGCCTACTTTTTTATCAGT Ku-0059436 research buy This study hlg-F ATAGAAGATATCGGCCAAGG This study hlg-R TTGCATCTTAACAACTAGGGC This study sak-F GACGCGAGTTATTTTGAACC This study sak-R TCTTTTGTAAGTGTAGTCCCAGG This study hysA-F GTTTGATGCTACA GAGAAAGAGG This study hysA-R CTGCGATTTTCTCAATATTACG This study sspA- F GGGT TATTAGGTTG GTCATCG This study sspA-R AAGTGATCGGAATTCATTGG This study gyrB-F ATCGACTTCAGAGAGAGGTTTG

[19] gyrB-R CCGTTATCCGTTACTTTAATCCA [19] Results MRSA strains with greater propensity to cause clinically invasive human infection showed increased fly killing activities We tested both feeding and pricking methods to compare the virulence of clinical MRSA strains in the fly model. Feeding experiments did not show significant differences among these strains in terms of the killing activities (data not shown). However, pricking experiments demonstrated that different clinical MRSA strains had distinct killing activities. Flies injected with plain BHI broth were included as a negative control, for which no flies were killed during the whole period of the experiment. USA300, USA400 and CMRSA2, previously shown to have a greater propensity to cause clinically invasive human infection [6], demonstrated high killing activities, with 51.4%, 60.3% and 72.8% of flies dead at 36 hours, and 83.5%, 84.9% and 97.7% of flies dead at 72 hours, respectively.

The first five categories were taken from existing classification systems (Australian Bureau of Statistics 1998; Higher Education Statistics Agency 2012; National Centre for Education Statistics 2012), while the last five categories were added by us to capture the structure of sustainability programs, using an iterative process (shown in Fig. 1) to develop categories based on courses in the sustainability degree programs ICG-001 nmr we analyzed Disciplinary category Definition Course subjects Natural Sciences Sciences that focus on processes in the

physical/natural as opposed to the human/social world, and mathematics Atmospheric Science, Biology, Chemistry, find more Earth Science, Ecology, Environmental Science, Geology, Hydrology, Mathematics, Physical Geography, Physics Social Sciences Sciences that focus on human behavior and social patterns and structures Anthropology, Communications, Conflict and Peace Studies, Cultural Studies, Demography, Development, Economics, Education, Environmental Sociology, Justice and Equity Studies, Law, Policy and Governance, Psychology, Sociology, Social Theory, Urban Sociology Engineering Identified by reference to engineering, design, machines, systems or technology. Distinguished

from applied sustainability by reference to these aspects of issues or problems alone, without social, environmental, political, or other context Architecture, Design for Sustainability, Energy Systems, Engineering, Information Technology, Planning, Transport Business Distinguished from social sciences by a focus on human organizations, especially businesses and management, including decision making and strategy Accounting, Assessment, Business Studies, Decision-Making, Finance, Leadership, Management, Marketing, NGOs and Advocacy, Organizational Studies, Participatory Processes,

Sustainable Business Practices Arts and Humanities Studies that focus on the processes and productions of human culture SB-3CT Composition, Ethics, History, Humanities, Literature, Philosophy, Religious Studies General Sustainability Identified by use of the words “sustainability” and “interdisciplinary”, and by reference to many disciplines. Often referred to environmental, social, and economic systems Introduction to Sustainability, Sustainable Development, Sustainability Seminar, Systems Thinking Applied Sustainability Identified when resources or problems appeared in course descriptions in the context of environmental, social, and economic aspects or impacts.